Newest DNA Questions | Wyzant Ask An Expert

02/20/22

Give a concrete scenario/occurrence that is analogous to the transcription and translation process

Hello! I am currently studying protein synthesis, but I am struggling to think of any scenario that could be comparable in certain aspects to the transcription and translation process of DNA. Thank... more

Follows • 4

Answers •1

Dna Science Genetics Living Systems

05/27/21

How Can changes to the information held in a DNA molecule or the amount of DNA in a cell affect protein and cell function and trait variation?

Follows • 1

Answers •1

Dna Biology Genetics Mutations

03/14/21

What is the amino acid sequence of this DNA? Note: There is a Single nucleotide mutation (underlined and bolded)

5'-TACCGAATAGAAATC-3'

Follows • 1

Answers •1

Dna Science

12/17/20

what is the complimentary strand of dna to this sequence: tacttcaaaaaccgaccgatc

Follows • 0

Answers •1

Dna Dna Replication

11/24/19

A particular triplet of bases in the template strand of DNA is AGT. The anticodon of the tRNA when the triplet bases are translated is...?

a. UGA.b. AGUc. TCA.d. AGT.

Follows • 1

Answers •1

Dna

10/22/19

DNA Repair in relation to cancer

Function of DNA repair in cancerous cells

Follows • 1

Answers •1

Dna Science Biology

10/02/19

what does DNA look like?

is a it a long bunched up strand or is it shaped like a chromosome (x shaped)?

Follows • 1

Answers •1

Dna Biochemistry

07/29/19

Basic Amino Acid Residue Binding Mechanism to DNA?

I understand that many protein DNA binding domains bind to DNA via basic residues such as Arginine and Lysine. But what is the mechanism used to bind to DNA and where on the DNA would these... more

Follows • 1

Answers •1

Dna Biology Cell Biology Molecular Biology

07/15/19

How much does the Hayflick limit/telomere length vary across taxa and within humans?

Since they seem to be quite connected, I'm curious if anyone knows of research comparing the Hayflick limit (and presumably by extension telomere length) between different taxa. I've heard the... more

Follows • 1

Answers •1

Dna Biology Cell Biology

07/07/19

DNA is charged negative. Where is all the positive charge in my body?

DNA is charged negative because of its phosphate backbone. Since charges need to be balanced (so that there are no charges building up somewhere), what is the positive charge which neutralizes this... more

Follows • 1

Answers •1

Dna Biology Cell Biology

07/06/19

What is the purpose of ethanol in a DNA extraction experiment?

We were doing a lab experiment in biology class in which we extracted DNA from a banana-detergent solution mixture.(The detergent solution was made of 100ml of detergent, 90ml of water, and 5g of... more

Follows • 1

Answers •2

Dna Biochemistry Molecular Biology Nucleic Acids

07/01/19

Why does high pH result in the denaturation of DNA?

In the Southern blot method, for example, a solution of NaOH is used to denature the DNA in the sample. I find this counterintuitive since I expected that $\ ext{Na}^+$ cations would neutralize... more

Follows • 1

Answers •1

Dna Biochemistry Lab Techniques Dna Isolation

06/26/19

What are the roles of guanidine-HCl and ethanol in binding of DNA to silica?

I'm trying to understand how exactly the binding to silica gel (in kits) step works and I cannot find any papers which provide an explanation of the physics or chemistry; especially on the way that... more

Follows • 2

Answers •1

Dna Genetics Protein Binding Transcription Factor

06/26/19

Do transcription factors bind to both strands of DNA?

Do transcription factors (or generally proteins) bind to only single strand of DNA or both strands? Since it can have non covalent bonds to both strands in theory. I would like to know the... more

Follows • 1

Answers •1

Dna Genetics Primer

06/25/19

How can you identify if a person is homozygous for a certain allele?

I've been thinking about starting a small private research project. In this project I need to find out whether a person is homozygous for a certain allele. The reason for this is that I'm really... more

Follows • 1

Answers •1

Dna Genetics Population Genetics

06/22/19

How can someone share 50% of their DNA with their parents yet all humans share 99.9%?

I have heard that humans share 99.9% of their DNA with other humans. I have also heard that a child shares 50% of their DNA with their parents. How do I resolve this apparent contradiction? It has... more

Follows • 1

Answers •1

Dna Genetics Molecular Genetics

06/14/19

Is there a term for when a detrimental gene can be positively selected for because of linkage to a very fit gene?

Let's say that some piece of DNA would be subject to extreme negative selection if it were independently inherited, but it is very closely linked to an extraordinarily fit gene, and so the complex... more

Follows • 1

Answers •1

Dna Biochemistry Molecular Genetics

06/14/19

What is the origin of "melting" in molecular genetics?

I'm reading some papers about prokaryotic transcription mechanisms, and I've come across a term I haven't heard before: *DNA melting* or *promoter melting*. After reading a bit, it's pretty clear... more

Follows • 1

Answers •1

Dna Biology Genetics Human Biology

06/13/19

Constant or variable number of chiasmata during recombination?

During recombination, is the number of chiasmata consistent for each gamete and are the chiasmata regions consistent within a single organism?

Follows • 1

Answers •1

Dna Biology Cell Reproduction

06/08/19

Do changes in an organism's cell modify the genetic information it uses for reproduction?

What I'm actually interested about is whether a modification in one cell during the life of an **asexually** reproducing organism affects its genetic information? Which cell's genetic information... more

Follows • 1

Answers •2

Dna Genetics Human Genome

06/01/19

Are there any DNA base sequences that are fully conserved between the genomes of all humans?

That is, they don't differ throughout the entire population. I understand of course that we can't DNA sequence every human, so by "fully" I mean there's an incredibly small probability of there... more

Follows • 1

Answers •1

Dna Biochemistry Molecular Biology Structural Biology

06/01/19

Why is the DNA helix anti-parallel?

Why is it that DNA strands are running in anti-parallel fashion? Given the chemical base-pairing, they could have been parallel just as well.

Follows • 1

Answers •1

Dna Biology Homework Mitosis

05/30/19

Chromosome and chromatid numbers during cell cycle phases?

A diploid cell in G1 has 6 chromosomes. How many chromosomes and how many chromatids are present in each of the following stages?Here is what I am guessing- G1: 6 chromosomes ; 6 chromatids - G2:... more

Follows • 1

Answers •2

Dna Biochemistry Senescence Chemical Communication

05/24/19

Free Radicals for aging?

From my understanding free radicals play a slight role in ageing.In what ways are they so damaging, and can a restricted diet reduce production of free radicals?

Follows • 1

Answers •1

Dna Biochemistry Molecular Biology Restriction Enzymes

05/21/19

What makes DNA sticky-ends sticky?

When restriction enzymes jaggedly cut double stranded DNA it results in so called sticky ends. What is the substance that makes the DNA sticky?

Follows • 1

Answers •1