66 Answered Questions for the topic DNA
02/20/22
Give a concrete scenario/occurrence that is analogous to the transcription and translation process
Hello! I am currently studying protein synthesis, but I am struggling to think of any scenario that could be comparable in certain aspects to the transcription and translation process of DNA. Thank...
more
05/03/21
If I have a DNA single strand like this 5' - TACGGTAGGTC-3' what will be the primer required for PCR (this primer should have only 5 nucleotides)
If I have a DNA single strand like this 5' - TACGGTAGGTC-3' what will be the primer required for PCR (this primer should have only 5 nucleotides)
What is the amino acid sequence of this DNA? Note: There is a Single nucleotide mutation (underlined and bolded)
5'-TACCGAATAGAAATC-3'
Dna Science
12/17/20
what is the complimentary strand of dna to this sequence: tacttcaaaaaccgaccgatc
Dna Dna Replication
11/24/19
A particular triplet of bases in the template strand of DNA is AGT. The anticodon of the tRNA when the triplet bases are translated is...?
a. UGA.b. AGUc. TCA.d. AGT.
what does DNA look like?
is a it a long bunched up strand or is it shaped like a chromosome (x shaped)?
Dna Biochemistry
07/29/19
Basic Amino Acid Residue Binding Mechanism to DNA?
I understand that many protein DNA binding domains bind to DNA via basic residues such as Arginine and Lysine. But what is the mechanism used to bind to DNA and where on the DNA would these...
more
07/15/19
How much does the Hayflick limit/telomere length vary across taxa and within humans?
Since they seem to be quite connected, I'm curious if anyone knows of research comparing the Hayflick limit (and presumably by extension telomere length) between different taxa. I've heard the...
more
07/07/19
DNA is charged negative. Where is all the positive charge in my body?
DNA is charged negative because of its phosphate backbone. Since charges need to be balanced (so that there are no charges building up somewhere), what is the positive charge which neutralizes this...
more
07/06/19
What is the purpose of ethanol in a DNA extraction experiment?
We were doing a lab experiment in biology class in which we extracted DNA from a banana-detergent solution mixture.(The detergent solution was made of 100ml of detergent, 90ml of water, and 5g of...
more
07/01/19
Why does high pH result in the denaturation of DNA?
In the Southern blot method, for example, a solution of NaOH is used to denature the DNA in the sample. I find this counterintuitive since I expected that $\ ext{Na}^+$ cations would neutralize...
more
06/26/19
What are the roles of guanidine-HCl and ethanol in binding of DNA to silica?
I'm trying to understand how exactly the binding to silica gel (in kits) step works and I cannot find any papers which provide an explanation of the physics or chemistry; especially on the way that...
more
06/26/19
Do transcription factors bind to both strands of DNA?
Do transcription factors (or generally proteins) bind to only single strand of DNA or both strands? Since it can have non covalent bonds to both strands in theory. I would like to know the...
more
How can you identify if a person is homozygous for a certain allele?
I've been thinking about starting a small private research project. In this project I need to find out whether a person is homozygous for a certain allele. The reason for this is that I'm really...
more
06/22/19
How can someone share 50% of their DNA with their parents yet all humans share 99.9%?
I have heard that humans share 99.9% of their DNA with other humans. I have also heard that a child shares 50% of their DNA with their parents. How do I resolve this apparent contradiction? It has...
more
06/14/19
Is there a term for when a detrimental gene can be positively selected for because of linkage to a very fit gene?
Let's say that some piece of DNA would be subject to extreme negative selection if it were independently inherited, but it is very closely linked to an extraordinarily fit gene, and so the complex...
more
06/14/19
What is the origin of "melting" in molecular genetics?
I'm reading some papers about prokaryotic transcription mechanisms, and I've come across a term I haven't heard before: *DNA melting* or *promoter melting*. After reading a bit, it's pretty clear...
more
06/13/19
Constant or variable number of chiasmata during recombination?
During recombination, is the number of chiasmata consistent for each gamete and are the chiasmata regions consistent within a single organism?
06/08/19
Do changes in an organism's cell modify the genetic information it uses for reproduction?
What I'm actually interested about is whether a modification in one cell during the life of an **asexually** reproducing organism affects its genetic information? Which cell's genetic information...
more
06/01/19
Are there any DNA base sequences that are fully conserved between the genomes of all humans?
That is, they don't differ throughout the entire population. I understand of course that we can't DNA sequence every human, so by "fully" I mean there's an incredibly small probability of there...
more
06/01/19
Why is the DNA helix anti-parallel?
Why is it that DNA strands are running in anti-parallel fashion? Given the chemical base-pairing, they could have been parallel just as well.
Chromosome and chromatid numbers during cell cycle phases?
A diploid cell in G1 has 6 chromosomes. How many chromosomes and how many chromatids are present in each of the following stages?Here is what I am guessing- G1: 6 chromosomes ; 6 chromatids - G2:...
more
05/24/19
Free Radicals for aging?
From my understanding free radicals play a slight role in ageing.In what ways are they so damaging, and can a restricted diet reduce production of free radicals?
Still looking for help? Get the right answer, fast.
Ask a question for free
Get a free answer to a quick problem.
Most questions answered within 4 hours.
OR
Find an Online Tutor Now
Choose an expert and meet online. No packages or subscriptions, pay only for the time you need.