Serafeane T.

asked • 12/17/20

what is the complimentary strand of dna to this sequence: tacttcaaaaaccgaccgatc

1 Expert Answer

By:

Julia F. answered • 01/03/21

Tutor
New to Wyzant

Online English, Writing, and Math Tutor

Still looking for help? Get the right answer, fast.

Ask a question for free

Get a free answer to a quick problem.
Most questions answered within 4 hours.

OR

Find an Online Tutor Now

Choose an expert and meet online. No packages or subscriptions, pay only for the time you need.