what is the complimentary strand of dna to this sequence: tacttcaaaaaccgaccgatc

Answer 1

If you are keeping this as a DNA sequence, you would match each letter with their appropriate corresponding nucleotide for DNA; A to T, G to C. These are the four nucleotides of DNA (adenine, thymine, guanine, and cytosine).

Therefore the first few would be ATGAA...

For every time you see a T, you would replace it with A and vice versa. Same rule applies to G and C.