4,365 Answered Questions for the topic Science

Science Math Physics

12/20/20

A 146 kg motorcycle is driving around a turn with a radius of 87.8 m at a constant speed of 12.1 m/s. What is the minimum force of friction required to prevent the cycle from sliding off of the road?
A 146 kg motorcycle is driving around a turn with a radius of 87.8 m at a constant speed of 12.1 m/s. What is the minimum force of friction required to prevent the cycle from sliding off of the road?
Follows • 1
Expert Answers •2
Science Chemistry Physics

12/18/20

kinetic friction

38. The coefficient of kinetic friction between an object and the surface upon which it is sliding is 0.25. The weight of the object is 20N. What is the force of friction? 39. The force of... more
Follows • 1
Expert Answers •1
Science Chemistry Physics

12/18/20

help 5 simple questions
Determine the Force of Gravity (Weight) of an object that has a mass of 6 kg A Brick that weighs 14N sits on a desk. What is the Normal Force supplied by the desk?  True or False: Normal Force is... more
Follows • 1
Expert Answers •2
Science Chemistry Physics

12/18/20

HELPPPP PLZ URGENT
Use any of the following equations to solve the problems. Show all workFN = mg W = mg gEARTH = 9.8 m/s2 1. What is the Normal Force supplied by a desk to a 2 kg book?2. What is the mass of a... more
Follows • 1
Expert Answers •1

12/17/20

Where will this image be located?
 The equation connecting s, p, and f for a simple lens can be employed for spherical mirrors, too. A concave mirror with a focal length of 7 cm forms an image of a small object placed 11 cm in... more
Follows • 2
Expert Answers •1

12/17/20

Determine the location of the image formed by the lens.

A small object is placed to the left of a convex lens and on its optical axis. The object is 32 cm from the lens, which has a focal length of 14 cm. Determine the location of the image formed by... more
Follows • 1
Expert Answers •1
Science Dna

12/17/20

what is the complimentary strand of dna to this sequence: tacttcaaaaaccgaccgatc
Follows • 0
Expert Answers •1

12/17/20

Cardiopulmonary Physiology Anatomy
Disease such as cardiogenic pulmonary edema can cause the placement of fluid in interstitial space, drastically reducing the diffusion of oxygen bringing about severe hypoxemia and even death. The... more
Follows • 1
Expert Answers •1

12/17/20

Enumerate at least three concrete applications of the importance of Mole concept in the field of Medicine.
The only applications I can think of are so doctors can avoid giving an overdose to their patients. Any suggestion is welcomed. Thank you!
Follows • 1
Expert Answers •1

12/17/20

mixed venous oxygen content?
What is the mixed venous oxygen content?The following blood gas data for a 27 y/o female are obtained:FI02 =                                  .21Spont. breathing=              f = 12     Hgb... more
Follows • 1
Expert Answers •1
Science Math Chemistry

12/16/20

What would the rate of the reaction be (in mol L−1 s−1) when concentration of A = 0.43 mol L−1, B = 0.185 mol L−1, and C = 0.207 mol L−1?
An experiment was designed to the study the reaction kinetics of a reaction that contains the reactants A, B, and C. Given the following data:A0 (mol L−1) B0 (mol L−1). C0 (mol L−1). Initial... more
Follows • 2
Expert Answers •1

12/16/20

Write 3y=12+4x in standard form

Follows • 1
Expert Answers •1
Science Biology

12/15/20

Population Dynamics
At the beginning of a year, there were 1923 painted turtles in a population. Over the year, 343 painted turtles were born, 176 died, 72 immigrated from other areas, and 12 emigrated.(a) Determine... more
Follows • 2
Expert Answers •1
Science Math Chemistry

12/15/20

An experiment was designed to the study the reaction kinetics of a reaction that contains the reactants A, B, and C. Given the following data:
An experiment was designed to the study the reaction kinetics of a reaction that contains the reactants A, B, and C. Given the following data:This is supposed to be a table:A0 (mol L−1) B0... more
Follows • 3
Expert Answers •3

12/15/20

 When an object 1.8 m (180 cm) away is being photographed, what is the magnification?
A camera is equipped with a lens with a focal length of 32 cm. When an object 1.8 m (180 cm) away is being photographed, what is the magnification?
Follows • 1
Expert Answers •1

12/15/20

When an object 1.6 m (160 cm) away is being photographed, how far from the film should the lens be placed?
A camera is equipped with a lens with a focal length of 22 cm. When an object 1.6 m (160 cm) away is being photographed, how far from the film should the lens be placed?
Follows • 1
Expert Answers •1

12/15/20

What is the magnification of the image?
The focal length of a diverging lens is negative. If f = −16 cm for a particular diverging lens, where will the image be formed of an object located 41 cm to the left of the lens on the optical... more
Follows • 1
Expert Answers •1

12/15/20

What is the magnification?
When viewed through a magnifying glass, a stamp that is 1.2 cm wide appears upright and 5.6 cm wide. What is the magnification?
Follows • 2
Expert Answers •1

12/15/20

How far from the lens (in cm) must the object be placed to accomplish this task, if the final image is located 20 cm from the lens?
A 2.8 cm-tall object stands in front of a converging lens. It is desired that a virtual image 2.4 times larger than the object be formed by the lens. How far from the lens (in cm) must the object... more
Follows • 1
Expert Answers •1
Science Biology Genetics

12/15/20

Genetics Cross Chart Question
In cross between a tall pea plant and a short plant, 60 plants were produced, 28 of which were tall and 32 were short. What are the genotypes of the parent plants? T represents the allele for... more
Follows • 1
Expert Answers •1
Science Math Chemistry

12/15/20

calculating fluids?
I have to do a math problem that requires to calculate fluid. I'm not sure what i did wrong or if i missed a step in this calculation.The doctor orders 6 mEq of potassium chloride (20 mEq/10 mL)... more
Follows • 1
Expert Answers •1

12/14/20

I'm very confused about this please help! (Hess Law)
Using the equations 2 C₆H₆ (l) + 15 O₂ (g) → 12 CO₂ (g) + 6 H₂O (g)∆H° = -6271 kJ/mol 2 H₂ (g) + O₂ (g) → 2 H₂O (g) ∆H° = -483.6 kJ/mol C (s) + O₂ (g) → CO₂ (g) ∆H° = -393.5 kJ/mol Determine the... more
Follows • 2
Expert Answers •1
Science Math Chemistry

12/14/20

2A + 3B → 4C At a certain point during the reaction shown above, the rate of appearance of C is measured to be 0.533 M/s. At this same point, what is the rate of the reaction?
2A + 3B → 4CAt a certain point during the reaction shown above, the rate of appearance of C is measured to be 0.533 M/s. At this same point, what is the rate of the reaction?
Follows • 2
Expert Answers •1

12/12/20

Why does tension increase with decreasing period?
A student can’t use a yoyo very well, so they swing it around their head in a horizontal circle. They notice the faster they swing it, the more tension there is in the string. They hypothesize that... more
Follows • 2
Expert Answers •1
Science Math Physics

12/11/20

5 Part Physics Question - Could somebody please help, please explain your answers to me, it would help me a lot
Caleb, an honor Chemistry student, went a ski trip with his friends to the Widham Ski Resort inNY. The careful Caleb chose one of blue routes to do downhill skiing, which is 30o slope, 100 mhigh,... more
Follows • 2
Expert Answers •2

Still looking for help? Get the right answer, fast.

Ask a question for free

Get a free answer to a quick problem.
Most questions answered within 4 hours.

OR

Find an Online Tutor Now

Choose an expert and meet online. No packages or subscriptions, pay only for the time you need.