4,355 Answered Questions for the topic Science
Science Dna
12/17/20
what is the complimentary strand of dna to this sequence: tacttcaaaaaccgaccgatc
12/17/20
Cardiopulmonary Physiology Anatomy
Disease such as cardiogenic pulmonary edema can cause the placement of fluid in interstitial space, drastically reducing the diffusion of oxygen bringing about severe hypoxemia and even death. The...
more
12/17/20
Enumerate at least three concrete applications of the importance of Mole concept in the field of Medicine.
The only applications I can think of are so doctors can avoid giving an overdose to their patients. Any suggestion is welcomed. Thank you!
mixed venous oxygen content?
What is the mixed venous oxygen content?The following blood gas data for a 27 y/o female are obtained:FI02 = .21Spont. breathing= f = 12 Hgb...
more
What would the rate of the reaction be (in mol L−1 s−1) when concentration of A = 0.43 mol L−1, B = 0.185 mol L−1, and C = 0.207 mol L−1?
An experiment was designed to the study the reaction kinetics of a reaction that contains the reactants A, B, and C. Given the following data:A0 (mol L−1) B0 (mol L−1). C0 (mol L−1). Initial...
more
Science Biology
12/15/20
Population Dynamics
At the beginning of a year, there were 1923 painted turtles in a population. Over the year, 343 painted turtles were born, 176 died, 72 immigrated from other areas, and 12 emigrated.(a) Determine...
more
An experiment was designed to the study the reaction kinetics of a reaction that contains the reactants A, B, and C. Given the following data:
An experiment was designed to the study the reaction kinetics of a reaction that contains the reactants A, B, and C. Given the following data:This is supposed to be a table:A0 (mol L−1) B0...
more
12/15/20
When an object 1.8 m (180 cm) away is being photographed, what is the magnification?
A camera is equipped with a lens with a focal length of 32 cm. When an object 1.8 m (180 cm) away is being photographed, what is the magnification?
12/15/20
When an object 1.6 m (160 cm) away is being photographed, how far from the film should the lens be placed?
A camera is equipped with a lens with a focal length of 22 cm. When an object 1.6 m (160 cm) away is being photographed, how far from the film should the lens be placed?
12/15/20
What is the magnification of the image?
The focal length of a diverging lens is negative. If f = −16 cm for a particular diverging lens, where will the image be formed of an object located 41 cm to the left of the lens on the optical...
more
12/15/20
What is the magnification?
When viewed through a magnifying glass, a stamp that is 1.2 cm wide appears upright and 5.6 cm wide. What is the magnification?
12/15/20
How far from the lens (in cm) must the object be placed to accomplish this task, if the final image is located 20 cm from the lens?
A 2.8 cm-tall object stands in front of a converging lens. It is desired that a virtual image 2.4 times larger than the object be formed by the lens. How far from the lens (in cm) must the object...
more
Genetics Cross Chart Question
In cross between a tall pea plant and a short plant, 60 plants were produced, 28 of which were tall and 32 were short. What are the genotypes of the parent plants? T represents the allele for...
more
calculating fluids?
I have to do a math problem that requires to calculate fluid. I'm not sure what i did wrong or if i missed a step in this calculation.The doctor orders 6 mEq of potassium chloride (20 mEq/10 mL)...
more
12/14/20
I'm very confused about this please help! (Hess Law)
Using the equations 2 C₆H₆ (l) + 15 O₂ (g) → 12 CO₂ (g) + 6 H₂O (g)∆H° = -6271 kJ/mol 2 H₂ (g) + O₂ (g) → 2 H₂O (g) ∆H° = -483.6 kJ/mol C (s) + O₂ (g) → CO₂ (g) ∆H° = -393.5 kJ/mol Determine the...
more
2A + 3B → 4C At a certain point during the reaction shown above, the rate of appearance of C is measured to be 0.533 M/s. At this same point, what is the rate of the reaction?
2A + 3B → 4CAt a certain point during the reaction shown above, the rate of appearance of C is measured to be 0.533 M/s. At this same point, what is the rate of the reaction?
12/12/20
Why does tension increase with decreasing period?
A student can’t use a yoyo very well, so they swing it around their head in a horizontal circle. They notice the faster they swing it, the more tension there is in the string. They hypothesize that...
more
5 Part Physics Question - Could somebody please help, please explain your answers to me, it would help me a lot
Caleb, an honor Chemistry student, went a ski trip with his friends to the Widham Ski Resort inNY. The careful Caleb chose one of blue routes to do downhill skiing, which is 30o slope, 100 mhigh,...
more
5 Part Physics Question - Could somebody please help, please explain your answers to me, it would help me a lot
Three blocks move on a surface with μs = 0.6 and μk = 0.4 as shown below. Jennifer, anotherhonor chemistry student, applied 34 N of force to move the system of three blocks, but shefailed. Assume...
more
Science
12/10/20
Is the observation "The plant has 7 strawberries on it" a quantitative or a qualitative observation?
Is the observation "The plant has 7 strawberries on it" a quantitative or a qualitative observation?quantitativequalitativebothneither
Compute the frequency (in MHz) of an EM wave with a wavelength of 5.3 in. (0.1346 m).
Compute the frequency (in MHz) of an EM wave with a wavelength of 5.3 in. (0.1346 m).
12/10/20
how many turns are there in the output coil?
The charger cord used to recharge a cell phone contains a transformer that reduces 120 V AC to 4 V AC. For each 1,225 turns in the input coil, how many turns are there in the output coil?
12/10/20
What is the temperature inside the furnace?
The blackbody radiation emitted from a furnace peaks at a wavelength of 4.1 10-6 m (0.0000041 m). What is the temperature inside the furnace?
12/10/20
how many turns must there be in the output coil?
The generator at a power plant produces AC at 19,000 V. A transformer steps this up to 355,000 V for transmission over power lines. If there are 1,850 turns of wire in the input coil of the...
more
Still looking for help? Get the right answer, fast.
Ask a question for free
Get a free answer to a quick problem.
Most questions answered within 4 hours.
OR
Find an Online Tutor Now
Choose an expert and meet online. No packages or subscriptions, pay only for the time you need.