4,347 Answered Questions for the topic Science

01/07/21

Physics question
What is the minimum radius at which an airplane flying at 300. m/s can make a U-turn if its centripetal acceleration is NOT to exceed 4 g’s (1g = 9.8m/s2)?
Follows • 1
Expert Answers •1

01/06/21

Question about epigenetics

Q1. Epigenetics is defined as ‘Changes to the genome which are inherited from one generation to the next which alter _____ _____ but do not involve changes in the ____ _____’.1. gene sequence;... more
Follows • 2
Expert Answers •1

01/06/21

create a paragraph for science class using these words

use the words that are bolded the rest is the meaning Element- a substance with atoms that are all alikeMatter- Anything that has mass and takes up space Solid- state of matter that has a definite... more
Follows • 1
Expert Answers •1

01/05/21

How to answer this question ?
Dave's serum was analysed by capillary zone electrophoresis with a UV detector set at 210nm and a large potential paraprotein was seen (shaded in panel A). Subsequent immunofixation studies (not... more
Follows • 2
Expert Answers •1

01/05/21

Chemistry Word Problem #2. Please help asap!
The optimal level of fluoride in drinking water suggested by the World Health Organization in 1994 is between 0.5mg/L and 1.0mg/L. How many moles of sodium fluoride would have to be added to pure... more
Follows • 1
Expert Answers •1

01/05/21

just need some help
What is the molarity concentration of sucrose in this sports drink?Molarity =            ( note: 1,000g of water-based fluids = 1 L )
Follows • 2
Expert Answers •1

01/05/21

need some more help
If this sugar was all sucrose (C12H22O11), how many moles of sucrose sugar is in 100g of this sports drink?
Follows • 1
Expert Answers •1

01/05/21

need some help with this
What is the molarity concentration of potassium chloride in this sports drink?Molarity =            ( note: 1,000g of water-based fluids = 1 L )
Follows • 1
Expert Answers •1

01/05/21

i need some help with math
I have a box of M&M bags. Each bag contains 25 M&Ms and are 20% red, 20% brown, 16% yellow, 16% blue, 16% orange, and 12% green.Jenna needs to collect green M&Ms for a special... more
Follows • 2
Expert Answers •1

12/31/20

physics question?
Sreshta is in her Lamborghini and trying to make a turn off a highway at 19.0 m/s. The turning radius of the curve is 35.0 m. Her car has a mass of 1240 kg.Determine the minimum coefficient of... more
Follows • 1
Expert Answers •1

12/31/20

physics question
In an effort to rev up her class, Ms. Player does a demonstration with a bucket of water that has a total mass of 1.8 kg. Ms. Player whirls the bucket in a vertical circle, of radius 1.3 m, such... more
Follows • 1
Expert Answers •2

12/30/20

Ventilation I:E Ratio Math Problem
If a patient's F = 12 and has a two second inspiration, his I:E ratio is?
Follows • 1
Expert Answers •1

12/27/20

How should I answer this question ?
Okay so this is the backround: A 45 year-old woman complaining of breast pain was diagnosed with having HER2-positive breast cancer. The patient underwent lumpectomy followed by a period of... more
Follows • 2
Expert Answers •2
Science Math Anatomy Nursing

12/26/20

Ventilation I:E Ratio
If a patient is observed to spend 0.8 seconds inspiring and 2.4 seconds exhaling, the patient's I:E ratio could be recorded as:
Follows • 1
Expert Answers •1

12/23/20

Which lung volume cannot be controlled?
Inspiratory Reserve Volume (IRV)Tidal Volume (VT)Residual Volume (RV)Inspiratory Capacity (IC)
Follows • 1
Expert Answers •1
Science Biology

12/23/20

write a paragraph using these words Natural selection Adaptation Fitness Heritable trait Survival of the fittest Variation
the wordsNatural selection Adaptation Fitness Heritable trait Survival of the fittest Variation
Follows • 1
Expert Answers •2
Science Math Physics

12/20/20

A 142 kg motorcycle is driving around a turn with a radius of 76 m at a constant speed of 19.3 m/s.
A 142 kg motorcycle is driving around a turn with a radius of 76 m at a constant speed of 19.3 m/s. What is the minimum force of friction required to prevent the cycle from sliding off of the road?
Follows • 1
Expert Answers •1
Science Math Physics

12/20/20

A car is driving around a turn with a radius of 22.2 m.
A car is driving around a turn with a radius of 22.2 m. If the coefficient of friction between the tires and the road is 1.38, what is the maximum speed the car can maintain around the turn without... more
Follows • 1
Expert Answers •1
Science Math Physics

12/20/20

A 146 kg motorcycle is driving around a turn with a radius of 87.8 m at a constant speed of 12.1 m/s. What is the minimum force of friction required to prevent the cycle from sliding off of the road?
A 146 kg motorcycle is driving around a turn with a radius of 87.8 m at a constant speed of 12.1 m/s. What is the minimum force of friction required to prevent the cycle from sliding off of the road?
Follows • 1
Expert Answers •2
Science Chemistry Physics

12/18/20

kinetic friction

38. The coefficient of kinetic friction between an object and the surface upon which it is sliding is 0.25. The weight of the object is 20N. What is the force of friction? 39. The force of... more
Follows • 1
Expert Answers •1
Science Chemistry Physics

12/18/20

help 5 simple questions
Determine the Force of Gravity (Weight) of an object that has a mass of 6 kg A Brick that weighs 14N sits on a desk. What is the Normal Force supplied by the desk?  True or False: Normal Force is... more
Follows • 1
Expert Answers •2
Science Chemistry Physics

12/18/20

HELPPPP PLZ URGENT
Use any of the following equations to solve the problems. Show all workFN = mg W = mg gEARTH = 9.8 m/s2 1. What is the Normal Force supplied by a desk to a 2 kg book?2. What is the mass of a... more
Follows • 1
Expert Answers •1

12/17/20

Where will this image be located?
 The equation connecting s, p, and f for a simple lens can be employed for spherical mirrors, too. A concave mirror with a focal length of 7 cm forms an image of a small object placed 11 cm in... more
Follows • 2
Expert Answers •1

12/17/20

Determine the location of the image formed by the lens.

A small object is placed to the left of a convex lens and on its optical axis. The object is 32 cm from the lens, which has a focal length of 14 cm. Determine the location of the image formed by... more
Follows • 1
Expert Answers •1
Science Dna

12/17/20

what is the complimentary strand of dna to this sequence: tacttcaaaaaccgaccgatc
Follows • 0
Expert Answers •1

Still looking for help? Get the right answer, fast.

Ask a question for free

Get a free answer to a quick problem.
Most questions answered within 4 hours.

OR

Find an Online Tutor Now

Choose an expert and meet online. No packages or subscriptions, pay only for the time you need.