Determine mRNA & Amino Acids in sequence

Question

Below is a sequence of eukaryotic DNA; determine the mRNA sequence and the polypeptide chain.

Underlined = introns

Not underlined = exons

DNA:

3’ATTGCGAGTCATTACCGAGCCTAGTATCGTTAAGAGCGGCGTCCAGGTTGACATACAGTGACTGTAGCC 5’

Answer 1

A couple of things to consider before starting the problem:

1. Since the question doesn't specifically say so, we are going to assume the mRNA we need to code is coded by the DNA (making DNA the coding strand)
2. DNA is antiparallel so when coded the mRNA will be in the 5' to 3' direction as opposed to the DNA which is in the 3' to 5' direction in the question.
3. tRNA reads the mRNA from the 5' to 3' direction.
4. Introns are non-coding DNA so they will be removed during RNA splicing. This means the mature mRNA will only contain the exons (not underlined)

We can now write the mRNA sequence taking above into account as:

5'-CUGUAAUGGCUCGGAUCUUCUCGCCGACUGUAUGUCACUGACAUCGG-3'

Now we have our coding sequence we will read it in the 5' to 3' direction starting at our start codon AUG (underlined). The Amino Acid Sequence sequence(polypeptide chain) is as follows based off the codon chart:

5'-AUG-GCU-CGG-AUC-UUC-UCG-CCG-ACU-GUA-UGU-CAC-UGA-3'

Met-Ala-Arg-Ile-Phe-Ser-Pro-Thr-Val-Cys-His-STOP