Write a function called get_genes(dna_string) that takes in a string of uppercase letters similar to the above, and returns a list of strings representing the genes in that DNA sequence.

Question

Write a function called get_genes(dna_string) that takes in a string of uppercase letters similar to the above, and returns a list of strings representing the genes in that DNA sequence.

The rules for how genes work are complex, but we’re going to make some simplifying assumptions: 

1. Individual genes are substrings that occur between three character start and stop codons (but they don’t include the codons themselves).
2. Genes always begin with the start codon: ATG 
3. Genes end with one of the following 3 stop codons: TAG, TAA or TGA.  
4. Start codons can appear anywhere in the string, followed by a series of nucleotides and ending with a stop codon.  
5. Every start codon will have a corresponding stop codon that occurs before the next start codon.  
6. The substrings ATG, TAG, TAA, and TGA will only occur at the start and end of genes.
7. No characters other than A, T, C, and G will be present in the string given.

For example, consider the following DNA sequence:

"TCATGTGCCCAATTCTGACCTACGATGGCCCAATAGCG"

The sequence above contains two genes, which have been underlined (the stop/start codons are shown in bold)::

"TCATGTGCCCAATTCTGACCTACGATGGCCCAATAGCG"

So get_genes("TCATGTGCCCAATTCTGACCTACGATGGCCCAATAGCG") would return the list: ["TGCCCAATTC", "GCCCAA"].

Answer 1

Hello there, I'm Brian. I'll try my best to guide you on this question without outright answering it for you so that you can learn a bit of the thought process and how to come up with the solution on your own.

We are given some important pieces of information when the question writes:

1. Genes always begin with the start codon: ATG 
2. Genes end with one of the following 3 stop codons: TAG, TAA or TGA.  
3. The substrings ATG, TAG, TAA, and TGA will only occur at the start and end of genes.

We essentially have a substring problem. We know how to start and end our substrings. We look for an ATG codon sequence to start our sequence. We are also looking for TAG, TAA, or TGA codons to end our sequence.

Let's take a look at the example

get_genes("TCATGTGCCCAATTCTGACCTACGATGGCCCAATAGCG") would return the list:

["TGCCCAATTC", "GCCCAA"].

In the example, the returned items are the sequences (without including the start and stop codons).

This means all we have to do is a loop through our list, looking for a start sequence ATG. Upon finding ATG, we should use a temporary string to track the characters while also looking for an end sequence TAG, TAA, or TGA. If we find the end sequence, then we can add our temporary string to a result list. We continue this process until we reach the end of the DNA sequence.

I hope that answers your question! Good luck on your assignment.