java programming

Question

2. A DNA sequence in FASTA format consists of a header line starting with a “>” sign, followed by a sequence identifier (GenBank Accession number, or clone name), and one or more lines of the sequence itself. Write a Java program to first prompt the user for a sequence identifier, such as “Enter a clone name: “, and then prompt for the DNA sequence. The program should print out a FASTA format sequence to the screen. An example output is listed below: (2 points)

>bi617a01
GCATGGCGTAAATTGCCCGTACGCTTAA

Answer 1

import java.io.*;

class DNA

{

public static void main(String args[])

{

String outBuff = ">";

Console console = System.console();

System.out.print(" Please input the clone name :>");

String inbuff = console.readLine();

outBuff = outBuff + inbuff;

System.out.print(" Please input the DNA sequence :>");

inbuff = console.readLine();

outBuff = outBuff + inbuff;

System.out.println(outBuff);

}

}