Search 75,891 tutors
FIND TUTORS

Naina B.'s Resources

Answers

glycolysis (answer)

Glycolysis is the anaerobic catabolism of glucose in absence of oxygen.  It converts one molecule of glucose into two molecules of pyruvic acid and that generates two molecules of ATP (phosphate containing molecule) through substrate phosphorylation by pyruvate kinase and PGK, another kinase...

Answers

help with basic and applied research (answer)

Hi  L,   Basic research implies to find and add information about basic knowledge. For instance, we know the structure of the cell at electron microscope level. However, if a company comes with live imager at EM level then it would give the information   about living...

Answers

help with solvent (answer)

You are right, it is solvent since it is dissolving the extract from leaves and making a solution.   I am not sure if it is two or multiple phases in the situation you describe. If the cup has not been disturbed and solution is not stirred then I think it is a gradient with concentrated...

Answers

Amount of Diluent (answer)

    Hope I am getting this right, Ml is milliliter. 500mg/ml is 0.5g/ml. Therefore, for a 5.0g vial, add 10ml od diluent to make a 0.5g/ml or 500mg/ml.   Hope this helps.

Answers

how do you keep honey bees away from your humming bird feeder? (answer)

It seems to me that there is something in your bird feeder (aroma or component) that is attracting honey bees. You may try using plain water and see if that helps. If it does then you would know for sure that something in your feed is attracting bees. They are usually attracted to sugar...

Answers

Please answer these....? (answer)

  Dear Roumya,   1. For  "who are you?"   "May I have your introduction please?"   2.  He forgot his arguments because of his nervousness.   3. You left before his arrival.     Hope this...

Answers

how did east india company bring good before 1865 (answer)

Amit,   To best of my recollection of Indian History, East India Company could not bring goods without permission from then Indian Rulers (Moghul Emperors), a representative from England approached the emperor seeking a trade agreement between India  and England.  As...

Answers

Describe the differences between Evolution and Revolution. (answer)

Elizabeth,   Evolution can be biological as well as cultural, essentially it implies to gradual change in biological organisms (biological evolution) or change in food habits, outfits/life-style, ideas (cultural evolution).   Revolution is essentially revolt or rebellion...

Answers

replicate this DNA strand. DNA:ATCGCGATCGCGTACGTACGTTTTCAGC (answer)

Hi Deborah,   here it is:   You have sequence of one strand of DNA, it would replicate as follows, A pairing with T and vice-versa, G pairing with C and vice versa. Below is double stranded DNA, during replication these two strands would separate and replicate following...

Answers

Do Crayfish show territories? Does the sex make a difference? (answer)

Thomas,   Crayfish in their natural habitat are territorial and go the spot abundant in their food for foraging. You can try with different flowerpots to monitor their response and behavior, it appears like an experiment worth trying.   Hope this helps.

Answers

How many genes do we have for each of our traits? (answer)

Dear Gloria,   In sixties, the hypothesis was one gene-one polypeptide. However, that concept has completely changed. The central dogma used to be:   Chromosome/DNA to mRNA to protein.   Again that has changed.   A gene or a locus can have multiple...

1 2 3 4 5